domingo, 2 de febrero de 2014

NO ESTOY MUERTA, POR DESGRACIA PARA ALGUNOS Parte I


LO SIENTO CABRONES PERO NO ESTOY MUERTA

PRIMERA PARTE 

Hola peña, que tal?

Bueno quería poner este mini post, para deciros que el blog esta paradito, porque mi salud no acompaña, mi espalda ha dicho ¡BASTA YAAA!.

En estos momentos, me estoy haciendo unas infiltraciones en la columna con opiáceos y corticoides, estoy en una lucha encarnizada para poder llevar una vida normal, o lo más normal posible, al menos con el menor dolor.



Al dolerme la espalda tantísimo y de forma crónica, mi ánimo se ve afectado y me cuesta tener la cabeza mínimamente lucida, con tanto opiáceo y tanto derivado de morfina, pues sinceramente  como que no me da pa mucho la cabeza, ya sin medicación no me da ni para una mierda jajajajaja.

Bueno pues os dejo un resumen de cosas que hemos estado haciendo en estos días de tanto silencio bloguero

Eso sí , os tengo que decir que me he acordado de vosotros toooooodos los días.

Aquí os dejo un resumen de este tiempo de ausencia:



Fuimos de excursión al campo, bueno el campo está a tres minutos de mi casa, lo dejamos en que fuimos al campo, yo me tuve que llevar una silla y no pude mover el culo de allí, eso sí disfrute del puto aire puro, del asco de bicho y boñigas de vaca, una alegría eso sí, el enano se lo paso pipa.

1.- con papa disfrutando del campito y una buena caminata que se dieron.

2.- después de jugar un súper partido de futbol de unos 4 minutos, el peque termino en bracitos de mama a gustito.

3.- A mi niño en el campo, todo le llama la atención, a él le encanta todo lo que a mí me asquito, pero se disimular muy bien y poner cara de asombro y súper mega chachi ilusión a cada bicho que trae, ains…

4.- Esta es mi cara de campo y como estaban en plena incursión militar por los árboles y matojos, yo me aburría y me hice peinados y fotos para parar tres pueblos, aquí uno de mis peinados, loca de ciudad en pleno verdor… al loro sudadera negra y foulard marrón color tierra hay que ir conjuntada aunque estés invalida como una piedra jajajajaja





CELEBRAMOS LOS CUMPLEAÑOS
Digo LOS cumpleaños porque el mismo día que mi madre nació, hace los años que ella aparenta , pues también nació mi segundo niño que este año ha cumplido 17 años, yo lo tuve con 6 años calculad CERDAS jajaja

Yo lo hice a posta, porque una tarta menos de cumple es una tarta menos, este año hicimos dos cumpleaños, uno con la familia muy potito y melancólico y otro que luego comentare.


En las fotos, podéis ver a mi hijo soplando la tarta que en esta ocasión es industrial, ya que el que hace las tartas es el jajajaja y todo colorado por la vergüenza.

Luego salgo yo haciendo la súper gilipollas como siempre y mi niño aprendiendo el oficio de gigolo, porque pito y cara tiene para serlo, ahora hay que aprender a poner morritos jajajaja.

Después MI Alberto con los chicos mayores, que me parece mentira que sean ya tan grandes.

Y abajo el yeye con sus bisnietos, una tierna foto del patriarca con las Android generaciones, aunque ahí donde le veis el yeye usa su tablet y su móvil que parece un niñato el joio, le quiero muuuuuuuucho y me encanta reunir a mi familia y disfrutarla.



Cuando tienes la movilidad tan reducida, que no solo tienes que estar sentada la mayor parte del día, si no que ni siquiera puedo pintar unas de mis pasiones, junto con el tatuaje y la música, la música puedo escucharla pero a mí me gusta tocarla, y ya no digo un lienzo , pero cuando ni siquiera puedo pintar a carboncillo, el tiempo se hace muyyyyy lento, empiezas a darle demasiadas vueltas a la cabeza, los días son interminables y sabes que cuando llega el final es para empezar otro con los mismo dolores y limitaciones, esto hace que te aburras y yo lo único que no puedo es estar aburrida, así que pues hago lo que puedo como por ejemplo fotos, ¿de qué? De todo jajajaja me da lo mismo que lo mismo me da, es más tengo una colección de cacas en el pañal diario del nene que es una pasada poca gente puede presumir de una colección de fotos tan escatológica y extensa jajajajaja




Este fue el día real del cumpleaños de mi hijo el 30 de noviembre, el otro cumpleaños familiar fue en realidad más tarde ahora que lo pienso, porque en mi casa, JAMAS se celebra un cumpleaños antes de tiempo, porque cuestión de superstición.

Pues el día empezó un poquito triste para mi hijo, porque su cumple coincidía con un viaje de mi marido a Madrid para hacer un examen y mi hijo aunque decía que no le importaba, pero era su primer cumpleaños sin que fuera un día súper especial, ya que nos inventamos que como su padre no estaba pues ya lo celebraríamos otro día, él no sabía lo que le esperaba, me lleve un mes súper liada organizando algo especial y bonito para “mi pequeñooooooo de almaaaaaa con su pieeeeeeeel de canelaaaaaa” y a través del móvil venga mensajito con la cómplice de mi hija, de mi madre y de Desi mi “ojala nuera” amiga de mi hijo.

La noche anterior hice como una especia de mini juego en el que dormíamos mi hijo mediano, mi hijo pequeño y yo hasta las tantas porque a las 12 de la noche ya era su cumple y su padre ya no estaba tenía el examen a las 8 de la mañana (vaya horitas mamones del gobierno, mata ilusiones de niños, corta rollos de cumpleaños) bueno nos pusimos de azúcar hasta el culo y hasta las dos de la mañana viendo la tele los tres en la cama.

Cuando se despertó le volvimos a felicitar el peke y yo y bueno yo en plan “hoy eres el rey de la casa”, vamos a ver las mierdas de series que te gustan juntos, y yo mientras tacataca tacatá con el móvil organizando, luego vamos a escuchar el concierto de Lana del Rey, cantara como quieras de bien pero a mí me entran ganas de suicidarme cada vez que la oigo, que tía más triste, perooooooo como era su cumple y no había celebración, escuchémosla aaarrggggg yo no podía más, yo seguía tacatá tacata tatatcacacatataaaaaa atacaaaaa riaaaa pitaaaaaa, ultimando detalles de lo que iba a ocurrir, inventando lo que me iba a inventar para que la invención no sonora muy inventada, empecé a hiperventilar, sudores fríos, taquicardias, pero disimulaba y seguía escuchando a la lacónica Lana del Rey ( puta provoca corte de venas).

YO -“Uy mira me está diciendo tu hermana que viene a casa” (todo estaba orquestado), “y dice la yaya que si puedes ir con tu hermana allí”.

MI HIJO- “uuufffff, mama estoy acoplado, no tengo ganas”.

YO- (por dentro……joputaaaaa, que me lo jodes todo, sudando hacia dentro, me tocaba el cuello con disimulo con dos dedos para ver mis constantes, creía que iba a tener que llamar al médico)……por fuera, improvisación rápida…”nene, no seas así que la yaya quiere darte un regalo por tu cumple y quería darte la sorpresa, anda ve con el enano y tu hermana cuando venga y luego te haces el sorprendido”.

MI HIJO “Alaaaaa mamaaaaa, que yo no sé disimular para que me dices eso”.

YO- (por dentro….cacho de carbón porque no querías ir, a ver cómo te arranco del sofá)….por fuera…”no pasa nada mi amor, tu pon cara de aaahhh que ilu, no me lo esperabaaa y ya está”.

Vino mi hija y le trajo un regalo, yo le di los otros, no se lo esperaba creía que íbamos a esperar al día de la celebración, en las fotos se puede apreciar que no tenía ni la más mínima idea de que le íbamos a dar los regalos, me encanta su cara de felicidad, cuanto le quiero…


Su padre, su hermana y yo le escribimos una carta cada uno, diciéndole todo lo que sentíamos por él, a parte de los regalos, mi hijo que es súper emotivo FOTO Nº5 esa es la cara de emotividad de mi hijo JAJAJAJA, se puso a leer la primera y empezó a asomarse un liquidillo por sus ojos y se emocionó FOTO Nº 6, y dijo que las leería a solas al día siguiente porque se iba a poner a llorar, me encanta es como yo.

SE FUEEEEEEEEEEEEEEEEEEEEE, al final logré que se fuera con su hermana y el enano, y ahí empezó la operación, "mama te va a hacer una fiesta de puta madre, para que te de verguenza y quieras matarla, pero nunca la vas a olvidar y luego estarás súper feliz"

Todo preparado, me puse manos a la obra, llame a mis cómplices para empezar a prepararlo todo, saque los adornos, la comida, refrescos al congelador, las 534 familiares fuera del escondite, todo estaba dispersado por la casa, en sitios astutamente complicados, mi hija al llegar había ido directita al escondite llamado “cuando vengas mete lo último que te encargue en la despensa, buaaaahhhh que emoción, solo pensar que él no se lo esperaba, yo no sabía si me querría por esto o me odiaría de por vida, todo el mundo sabe que mi hijo es extraordinariamente tímido, pero me daba lo mismo se lo merecía, me apetecía, y le quiero tanto que ya no sé qué hacer para podérselo demostrar porque soy la más “jartible” diciéndole te quiero, abrazándole, besándole y todo de todo, es un solete.



Cuando mi hijo llego a casa por supuestoooooooooooooooooo!!!!!! of courseeeeeee!!!!!!! Se le cayeron los gayumbos, fue la típica fiesta sorpresa que realmente es sorpresa y no se hule nada, porque a mi rara vez me la han pegado jajajaja.


Cuando mi hijo entro y escucho el ¡FELICIDADEEEEESSSSS! Se le ilumino la cara, y la sonrisa que surgió en su rostro, fue comparable solo a la que tenía el día de reyes cuando aún era un niño pequeño, para mí fue genial, también fue estupendo ver lo mucho que le quieren, me ayudaron tanto su hermana como sus amigas que le hicieron la tarta (abajo he puesto una foto soplando la tarta que le hicieron, buenísima por cierto ñam ñam) ellas mismas, y sobre todo su amiga Desi que fue mi mano derecha, fue genial ver como chicas/os de la edad de mi hijo pueden pasárselo bien de manera sana, le baje el equipo de música, prepare pizzas para dos o tres equipo de Rugby, compre todas las guarrerías de chuches que se me ocurrieron, globos, bandolera de felicidades para el cumpleañeros.




Las primeras fotos están desencuadradas porque estaba toda la casa a oscuras, hice lo que pude jajajajaja

La cara de mi hijo lo dice todo, SORPRESA, INCREDULIDAD, ALEGRIA….no tiene precio, todo el trabajo que tuve durante mas de un mes, preparativos, secretos, compras y escondites, todo merecio la pena.

Las amigas que son cachondisimas, hicieron que todo el preparativo mientras estaba fuera mi hijo, fuese de lo mas divertido, lo que me pude reir, bueno lo que me dejaron los nervios…..


Me encanto ver lo mucho que le querían y todas decían “se lo merece, porque es un amigo de verdad y nos lo demuestra a toda la pandilla”, fue una pena porque los padres no dejaron venir a los demás amigos y amigas de la pandilla porque eran de pueblos cercanos y no se les da miedo todo, joder como para que estudien en Londres . Desi aunque es la que mas lejos vive pudo venir y la dejaron quedarse a dormir, le doy las gracias desde aquí porque sin ella no hubiera sido posible este precioso momento.

Mi cara es de madre babosa, pero es lo que soy una mama babosa, reminiscencias gotikas pero babosa jajajajaja, la foto en la que  estoy con mis tres niños me encanta, ese fue el primer matasuegras del enano y nuestra vida ya no ha vuelto a ser la misma, ahora se los busco en tiendas tipo partys porque le encantan jajajaja



Buscamos un D.J. de lujo como se puede ver en la segunda foto, el tío disfruto de lo lindo, en esta fiesta de menores, me di cuenta que la cafeína y el azúcar tienen el mismo efecto que una tanda de rayas de coca en otras fiestas en las que supuestamente he podido estar en algún supuesto momento de una supuesta etapa de mi vida jajajajajaja y la paliza a bailar que se dieron como personas poseídas por algún demonio que ni el padre Carras podría haber determinado, mas todo lo que se reían hicieron a las tantas el mismo efecto que una buena tanda de porros que podría haber visto en alguna supuesta reunión de algunos supuestos amigos que supuestamente podrían haber fumado marihuana ains espero que no me caiga ninguna querella jajajajaja.


Yo hice cinco toneladas de pizzas y me retire a mis aposentos, bajaba de vez en cuando sigilosamente por las escaleras por si hacían lo que yo habría hecho con su edad, coger las bebidas alcohólicas de mi casa y hacer cubatas, beber chupitos, fumarme un porro, todo aprovechando que mi padre está arriba y encima seguramente se ha tomado las pastillas, pero nada!!! Cada vez que bajaba estaban o tocando la guitarra eléctrica, o cantando, o bailando, o comiendo o charlando o riéndose, pero sin ninguna sustancia más allá de la cafeína y el azúcar, dios si no lo veo no me lo creo, en cierta manera me dio un poco de miedo y grima esta generación es tan distinta a la mía que no sé si es muy bueno o muy malo, son tan…….SANOOOOOOSSSS JODEEEERRRRR.

La verdad que no habría estado bien lo contrario más que nada porque yo era la responsable de todos esos menores hormonados y si encima hubieran estado fumados y borrachos, a ver con qué cara reparto menores en su casa, creo que lo habría hecho con la técnica huérfano en canastita de mimbre pero sin canasta, timbre y fiuuuu a correr recoge a tu niña antes de que se ahogue en su propio vomito jajajajaja, pero no lo único que tuve que hacer fue bajar a las 11:55 y decir “por favor podéis poner bajita la música, para no molestar a los vecinos”  antes de terminar la frase, ya habían quitado la música, eso también me dio muuuuuuucha grima, un escalofrió recorrió mi columna dios que obedientes todos, luego las risas se escuchaban más que la música, pero eso no es ilegal así que si les molestaban a los vecinos que se jodieran. 





Lo dicho se lo pasaron de puta madre, en la foto en la que bailando quise poner esta, porque es que esooooo eraaaaa realmente lo que pasabaaaaa jajajajaja.

El peke aparte de D.J.  también hizo de relaciones públicas, él hablaba con todo el mundo se presentaba y les preguntaba el nombre, si realmente es súper mono y se lo comieron jajajaja.






La pandilla decidió hacerle algo que había ocurrido antes jajajaja LE ESCRIBIERON UNA CARTAAAAAA CON LO QUE TODOS LOS INTEGRANTES DE LA "SANOS PANDI " pensaban de mi retoñito, en la última foto se ve la mirada de mi hijo de “mama te odio y no ganaras para pagar mis terapias” me meo cada vez que veo esta foto, porque dijo lo mismo que a nosotros de “luego la leo solo” y le dijeron y una leche te vamos a leer un trocito cada una jajajaja y paso un mal rato de cojones y luego abrazos , besos etc… que tio más encantador y más especial es mi hijo, y cuantos amigos tiene, es un ser irrepetiblemente especial, tan sensible, con tanta serenidad espiritual, tan responsable, tan dulce y generoso, admiro mucho a mi hijo, a parte de ser valiente y con mucha autoestima, claro que también tiene que ver porque su padre y yo le hemos educado a la perfección (que modesta) 

MAS COSAS QUE HAN PASADO EN MI AUSENCIA BLOGUERA



MIS MASCOTAS, BUENOS MIS COMPAÑEROS COMPAÑEROS DE CASA

Hacen que este reposo se me haga mucho más ameno, verlos jugar entre ellos, o con mi pequeño me da muchos momentos tiernos y divertidos, nadie sabe lo que es pasar tanto tiempo sin hacer cosas que para la mayoría son hasta tediosos, como ir andando a cualquier parte, o simplemente poder estar de pie hablando con alguien mientras te fumas un cigarro.


Pues mis amigos peludos y no me refiero a los colegas que llevan barbas y melenas, si no a mis perro y a la psicópata de mi gata me hacen este reposo impuesto y doloroso en el sentido textual de la palabra mucho más edulcorado.






LUEGO ESTA ELLA

Que puedo decir de mi gatita, es…..blanca y negra….es chucha….es adoptada…y es una psicópata que lo único que le inspira en la vida es la forma de matarme jajajaja, es una chica independiente, tiene la firme convicción de que por ser una gata no ha nacido para ronronear y dejarse sobar para relajar a sus dueños, eso es lo que me gusta de ella, eso y que realmente siempre se las apaña para esconderse y asustarme, pero siempre está cerca de mí, siempre a mi lado, aunque no le gusta el contacto físico, solo cuando ella lo desea y eso también me parece especial en ella.

Le encanta jugar con mi pequeño, se pone en un sitio alto y le da toquecitos en la cabeza, como mini “mecos” jajajaja, aunque la pise sin querer JAMAS le saca las uñas, algo que la pirra es dormir con el peque siempre la siesta, es increíble el vínculo que tienen todos los animales que comparten nuestra vida con el pequeño, y no es rarita como otras gatas que los dueños las tienen agilipolladas, ella es libre de cuerpo y espíritu, odio a los gatos enchochados y amariconados aarrgggg.

Nunca había tenido gatos en mi vida y ella no fue ni la más bonita, ni la raza que yo soñaba ni nada de lo que yo voluntariamente hubiera elegido, empezando porque quería un macho jajajaja, pero ella fue la elegida para entrar en nuestras vidas.




Mirar a un gato jugar es lo más tronchante del mundo, a aparte de tocarle los cojones que a mí me divierte un huevo porque en el fondo le encanta, realmente me adora, es mi sombra es más terminó cayéndose a la bañera porque cuando me baño va andando por el filito, pero no le gusta que la usen como a un objeto y se la utilice como quita stress.

He de reconocer que aunque no se despegue de mí, imagino que le causa todo curiosidad, su real debilidad es mi hijo mediano, duerme con él, cuando quiere que la acaricien va a su regazo, y como es tan grande se pone en su nuca cuando está estudiando jajajajaja


Realmente si estáis solos, si vivís en un pequeño apartamento, si  queréis un gran compañero de piso y vida, os aconsejo un gatito o incluso dos se crían mejor.



Aunque me queje del hecho de que me quiere matar, pero realmente también hace que mis momentos de dolor y desesperación sean más pasables, se merece un trocito de mi blog porque tiene un gran trozo de mi corazón.

CONTINUARA...............





Image and video hosting by TinyPic